Transcriptome analysis of soybean WRKY TFs in response to Peronospora manshurica infection.

Soybean downy mildew (SDM) caused by Peronospora manshurica (Pm) is a common disease of soybean that occurs wherever soybean is grown. In order to provide new insights about the defense mechanism of soybean response to Pm infection, differential expression of WRKY transcription factors (TFs) in SDM-high resistant (HR) and SDM-high susceptible (HS) genotypes were analyzed in this study. Totally, 22 WRKY TFs were differentially expressed in HR and HS genotype, while 16 WRKY TFs were found to be specific in response to fungal inoculation. By yeast one-hybrid (Y1H) assay, the GmWRKY31 was characterized to be able to bind the cis-acting W-box element in the promoter region of the GmSAGT1 gene whose higher transcriptional expression was associated with enhanced SDM-resistance. This result of Y1H assay, together with the activation of GmSAGT1 both by SA (salicylic acid) induction and Pm infection in vivo, let us to speculate that the GmWRKY31 might regulate the GmSAGT1 gene expression and involve in SA-mediated immune responses in soybean.

Effectiveness of AOS-iron on iron deficiency anemia in rats.

Iron deficiency anemia (IDA) is one of the most serious nutritional problems. This study aimed to evaluate the therapeutic effects of a novel agar oligosaccharide-iron complex (AOS-iron) on rats with IDA, such as iron supplementation and recovery of antioxidant ability. Eighty-four weaned male SD rats were randomly divided into a normal control group (n = 12), which was fed with a standard diet, and an anemia model group (n = 72), which was fed with an iron-deficient diet for 4 weeks to establish a model of IDA. After the model was established, the rats with IDA were divided into six groups, namely, an anemia model group, a ferrous gluconate group, a ferrous sulfate (FeSO4) group, and low-dose (LD), medium-dose (MD) and high-dose (HD) AOS-iron groups, and fed with an iron-deficient diet and different iron supplements for 4 weeks, respectively. The results showed that HD AOS-iron exerted a significant restorative effect by returning blood parameters to normal levels in rats with IDA, including hemoglobin, red blood cells, hematocrit, mean cell volume, mean cell hematocrit, mean cell hemoglobin concentration, serum iron, total iron binding capacity, transferrin saturation, and serum ferritin. A histological analysis suggested that the liver morphology in the MD and HD AOS-iron groups was similar to that in the normal group. Furthermore, MD and HD AOS-iron improved antioxidant activities in the serum and liver. In general, high-dose (the same dose as those of ferrous gluconate and FeSO4) AOS-iron exhibited the best effects in terms of iron supplementation and antioxidant activities. The present findings showed that AOS-iron might be a potential new iron supplement.

Transcriptomic analysis of genes in soybean in response to Peronospora manshurica infection.

BACKGROUND: Soybean downy mildew (SDM), caused by Peronospora manshurica (Pm), is a major fungal disease in soybean. To date, little is known regarding the defense mechanism at molecular level and how soybean plants response to Pm infection. In this study, differential gene expression in SDM-resistant (HR) and SDM-susceptible (HS) genotype was analyzed by RNA-seq to identify differentially expressed genes (DEGs) following Pm infection. RESULTS: Of a total of 55,017 genes mapped to the soybean reference genome sequences, 2581 DEGs were identified. Clustering analysis of DEGs revealed that these genes could be grouped into 8 clusters with distinct expression patterns. Functional annotation based on gene ontology (GO) and KEGG analysis indicated they involved in diverse metabolism pathways. Of particular interest were the detected DEGs participating in SA/ROS and JA signalling transduction and plant/pathogen interaction. CONCLUSION: Totally, 52 DEGs with P value < 0.001 and log2 fold change > 2 or < - 2 upon fungal inoculation were identified, suggesting they were SDM defense responsive genes. These findings have paved way in further functional characterization of candidate genes and subsequently can be used in breeding of elite soybean varieties with better SDM-resistance.

Transcriptomic analysis of the primary roots of Alhagi sparsifolia in response to water stress.

BACKGROUND: Alhagi sparsifolia is a typical desert phreatophyte and has evolved to withstand extreme dry, cold and hot weather. While A. sparsifolia represents an ideal model to study the molecular mechanism of plant adaption to abiotic stress, no research has been done in this aspect to date. Here we took advantage of Illumina platform to survey transcriptome in primary roots of A. sparsifolia under water stress conditions in aim to facilitate the exploration of its genetic basis for drought tolerance. METHODOLOGY AND PRINCIPAL FINDINGS: We sequenced four primary roots samples individually collected at 0, 6, 24 and 30h from the A. sparsifolia seedlings in the course of 24h of water stress following 6h of rehydration. The resulting 38,763,230, 67,511,150, 49,259,804 and 54,744,906 clean reads were pooled and assembled into 33,255 unigenes with an average length of 1,057 bp. All-unigenes were subjected to functional annotation by searching against the public databases. Based on the established transcriptome database, we further evaluated the gene expression profiles in the four different primary roots samples, and identified numbers of differently expressed genes (DEGs) reflecting the early response to water stress (6h vs. 0h), the late response to water stress (24h vs. 0h) and the response to post water stress rehydration (30h vs. 24h). Moreover, the DEGs specifically regulated at 6, 24 and 30h were captured in order to depict the dynamic changes of gene expression during water stress and subsequent rehydration. Functional categorization of the DEGs indicated the activation of oxidoreductase system, and particularly emphasized the significance of the 'Glutathione metabolism pathway' in response to water stress. CONCLUSIONS: This is the first description of the genetic makeup of A. sparsifolia, thus providing a substantial contribution to the sequence resources for this species. The identified DEGs offer a deep insight into the molecular mechanism of A. sparsifolia in response to water stress, and merit further investigation.

Design and identification of a high efficient formic acid cleavage site for separation of fusion protein.

The release of target protein with high efficiency and low cost from expressed fusion protein is a key requirement for commercial production of target proteins. To establish such a cleavage system, we have designed four formic acid (FA) cleavage sites C1 (DPDPDP), C2 (DPPDPP), C3 (DDDDPI) and C4 (IVDPNP), which was placed in between the E and G fusion protein. Four expression vectors were individually constructed and expressed in Escherichia coli. Purified proteins were reacted with a series of FA concentrations or under different temperatures followed by SDS-PAGE gel electrophoresis to verify the degree of cleavage efficiency. Results showed that the C2 was the most efficient site compared with the other three. After optimization of cleavage conditions for E-C2-G, the cleavage efficiently could reach as high as 87.3% within 2.5 h in 37% FA at 45 °C. Comparing with previous reports, a significant reduction (26%) of FA concentration at a lower temperature in a short duration of reaction (18 times less) was achieved. We believe the cleavage site of DPPDPP identified in this study can be used in the large-scale production of valuable fusion proteins to save the cost, time and energy.

Rice transgene flow: its patterns, model and risk management.

Progress has been made in a 12 year's systemic study on the rice transgene flow including (i) with experiments conducted at multiple locations and years using up to 21 pollen recipients, we have elucidated the patterns of transgene flow to different types of rice. The frequency to male sterile lines is 10(1) and 10(3) higher than that to O. rufipogon and rice cultivars. Wind speed and direction are the key meteorological factors affecting rice transgene flow. (ii) A regional applicable rice gene flow model is established and used to predict the maximum threshold distances (MTDs) of gene flow during 30 years in 993 major rice producing counties of southern China. The MTD0.1% for rice cultivars is basically ≤5 m in the whole region, despite climate differs significantly at diverse locations and years. This figure is particularly valuable for the commercialization and regulation of transgenic rice. (iii) The long-term fate of transgene integrated into common wild rice was investigated. Results demonstrated that the F1 hybrids of transgenic rice/O. rufipogon gradually disappeared within 3-5 years, and the Bt or bar gene was not detectable in the mixed population, suggesting the O. rufipogon may possess a strong mechanism of exclusiveness for self-protection. (iv) The flowering time isolation and a 2-m-high cloth-screen protection were proved to be effective in reducing transgene flow. We have proposed to use a principle of classification and threshold management for different types of rice.

Gene-splitting technology: a novel approach for the containment of transgene flow in Nicotiana tabacum.

The potential impact of transgene escape on the environment and food safety is a major concern to the scientists and public. This work aimed to assess the effect of intein-mediated gene splitting on containment of transgene flow. Two fusion genes, EPSPSn-In and Ic-EPSPSc, were constructed and integrated into N. tabacum, using Agrobacterium tumefaciens-mediated transformation. EPSPSn-In encodes the first 295 aa of the herbicide resistance gene 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) fused with the first 123 aa of the Ssp DnaE intein (In), whereas Ic-EPSPSc encodes the 36 C-terminal aa of the Ssp DnaE intein (Ic) fused to the rest of EPSPS C terminus peptide sequences. Both EPSPSn-In and Ic-EPSPSc constructs were introduced into the same N. tabacum genome by genetic crossing. Hybrids displayed resistance to the herbicide N-(phosphonomethyl)-glycine (glyphosate). Western blot analysis of protein extracts from hybrid plants identified full-length EPSPS. Furthermore, all hybrid seeds germinated and grew normally on glyphosate selective medium. The 6-8 leaf hybrid plants showed tolerance of 2000 ppm glyphosate in field spraying. These results indicated that functional EPSPS protein was reassembled in vivo by intein-mediated trans-splicing in 100% of plants. In order to evaluate the effect of the gene splitting technique for containment of transgene flow, backcrossing experiments were carried out between hybrids, in which the foreign genes EPSPSn-In and Ic-EPSPSc were inserted into different chromosomes, and non-transgenic plants NC89. Among the 2812 backcrossing progeny, about 25% (664 plantlets) displayed glyphosate resistance. These data indicated that transgene flow could be reduced by 75%. Overall, our findings provide a new and highly effective approach for biological containment of transgene flow.

Construction of a standard reference plasmid containing seven target genes for the detection of transgenic cotton.

Insect resistance and herbicide tolerance are the dominant traits of commercialized transgenic cotton. In this study, we constructed a general standard reference plasmid for transgenic cotton detection. Target genes, including the cowpea trypsin gene cptI, the insect resistance gene cry1Ab/1Ac, the herbicide tolerance gene cp4-epsps, the Agrobacterium tumefaciens nopaline synthase (Nos) terminator that exists in transgenic cotton and part of the endogenous cotton SadI gene were amplified from plasmids pCPT1, pBT, pCP4 and pBI121 and from DNA of the nontransgenic cotton line K312, respectively. The genes cry1Ab/1Ac and cptI, as well as cp4-epsps and the Nos terminator gene, were ligated together to form the fusion genes cptI-Bt and cp4-Nos, respectively, by overlapping PCR. We checked the validity of genes Sad1, cptI-Bt and cp4-Nos by DNA sequencing. Then, positive clones of cptI-Bt, cp4-Nos and Sad1 were digested with the corresponding restriction enzymes and ligated sequentially into vector pCamBIA2300, which contains the CAMV 35S promoter and nptII gene, to form the reference plasmid pMCS. Qualitative detection showed that pMCS is a good positive control for transgenic cotton detection. Real-time PCR detection efficiencies with pMCS as a calibrator ranged from 94.35% to 98.67% for the standard curves of the target genes (R(2)⩾0.998). The relative standard deviation of the mean value for the known sample was 11.95%. These results indicate that the strategy of using the pMCS plasmid as a reference material is feasible and reliable for the detection of transgenic cotton. Therefore, this plasmid can serve as a useful reference tool for qualitative and quantitative detection of single or stacked trait transgenic cotton, thus paving the way for the identification of various products containing components of transgenic cotton.

Establishment and optimization of a regionally applicable maize gene-flow model.

Because of the rapid development of transgenic maize, the potential effect of transgene flow on seed purity has become a major concern in public and scientific communities. Setting a proper isolation distance in field experiments and seed production is a possible solution to meet seed-quality standards and ensure adventitious contamination of products is below a specific threshold. By using a Gaussian plume model as basis and data recorded by meteorological stations as input, we have established a simple regionally applicable maize gene-flow model for prediction of the maximum threshold distances (MTD) at which gene-flow frequency is equal to or lower than a threshold value of 1 or 0.1 % (MTD1%, MTD0.1%). After optimization of the model variables, simulated outcrossing rate was a good fit to data obtained from field experiments (y = 1.156x, R (2) = 0.8913, n = 30, P < P 0.01). In the process of model calibration, it was found that only 15.82 % of the total amount of the pollen released by each plant participated in the dispersal process. The variable "a" for genetic pollen competitiveness between donor and recipient was introduced into our model, for the "Zinuo18" and "Su608" used, "a" was 17.47. Finally, the model was successfully used in the spring maize-growing region of Northeast China. The range of MTD1% and MTD0.1% in this region varied from 10 m to 49 m and from 17 m to 125 m, respectively.

Presence of poly(A) and poly(A)-rich tails in a positive-strand RNA virus known to lack 3׳ poly(A) tails.

Here we show that Tobacco mosaic virus (TMV), a positive-strand RNA virus known to end with 3׳ tRNA-like structures, does possess a small fraction of gRNA bearing polyadenylate tails. Particularly, many tails are at sites corresponding to the 3׳ end of near full length gRNA, and are composed of poly(A)-rich sequences containing the other nucleotides in addition to adenosine, resembling the degradation-stimulating poly(A) tails observed in all biological kingdoms. Further investigations demonstrate that these polyadenylated RNA species are not enriched in chloroplasts. Silencing of cpPNPase, a chloroplast-localized polynucleotide polymerase known to not only polymerize the poly(A)-rich tails but act as a 3׳ to 5׳ exoribonuclease, does not change the profile of polyadenylate tails associated with TMV RNA. Nevertheless, because similar tails were also detected in other phylogenetically distinct positive-strand RNA viruses lacking poly(A) tails, such kind of polyadenylation may reflect a common but as-yet-unknown interface between hosts and viruses.

Identification and functional analysis of flowering related microRNAs in common wild rice (Oryza rufipogon Griff.).

BACKGROUND: MicroRNAs (miRNAs) is a class of non-coding RNAs involved in post- transcriptional control of gene expression, via degradation and/or translational inhibition. Six-hundred sixty-one rice miRNAs are known that are important in plant development. However, flowering-related miRNAs have not been characterized in Oryza rufipogon Griff. It was approved by supervision department of Guangdong wild rice protection. We analyzed flowering-related miRNAs in O. rufipogon using high-throughput sequencing (deep sequencing) to understand the changes that occurred during rice domestication, and to elucidate their functions in flowering. RESULTS: Three O. rufipogon sRNA libraries, two vegetative stage (CWR-V1 and CWR-V2) and one flowering stage (CWR-F2) were sequenced using Illumina deep sequencing. A total of 20,156,098, 21,531,511 and 20,995,942 high quality sRNA reads were obtained from CWR-V1, CWR-V2 and CWR-F2, respectively, of which 3,448,185, 4,265,048 and 2,833,527 reads matched known miRNAs. We identified 512 known rice miRNAs in 214 miRNA families and predicted 290 new miRNAs. Targeted functional annotation, GO and KEGG pathway analyses predicted that 187 miRNAs regulate expression of flowering-related genes. Differential expression analysis of flowering-related miRNAs showed that: expression of 95 miRNAs varied significantly between the libraries, 66 are flowering-related miRNAs, such as oru-miR97, oru-miR117, oru-miR135, oru-miR137, et al. 17 are early-flowering -related miRNAs, including osa-miR160f, osa-miR164d, osa-miR167d, osa-miR169a, osa-miR172b, oru-miR4, et al., induced during the floral transition. Real-time PCR revealed the same expression patterns as deep sequencing. miRNAs targets were confirmed for cleavage by 5'-RACE in vivo, and were negatively regulated by miRNAs. CONCLUSIONS: This is the first investigation of flowering miRNAs in wild rice. The result indicates that variation in miRNAs occurred during rice domestication and lays a foundation for further study of phase change and flowering in O. rufipogon. Complicated regulatory networks mediated by multiple miRNAs regulate the expression of flowering genes that control the induction of flowering.

De novo foliar transcriptome of Chenopodium amaranticolor and analysis of its gene expression during virus-induced hypersensitive response.

BACKGROUND: The hypersensitive response (HR) system of Chenopodium spp. confers broad-spectrum virus resistance. However, little knowledge exists at the genomic level for Chenopodium, thus impeding the advanced molecular research of this attractive feature. Hence, we took advantage of RNA-seq to survey the foliar transcriptome of C. amaranticolor, a Chenopodium species widely used as laboratory indicator for pathogenic viruses, in order to facilitate the characterization of the HR-type of virus resistance. METHODOLOGY AND PRINCIPAL FINDINGS: Using Illumina HiSeq™ 2000 platform, we obtained 39,868,984 reads with 3,588,208,560 bp, which were assembled into 112,452 unigenes (3,847 clusters and 108,605 singletons). BlastX search against the NCBI NR database identified 61,698 sequences with a cut-off E-value above 10(-5). Assembled sequences were annotated with gene descriptions, GO, COG and KEGG terms, respectively. A total number of 738 resistance gene analogs (RGAs) and homology sequences of 6 key signaling proteins within the R proteins-directed signaling pathway were identified. Based on this transcriptome data, we investigated the gene expression profiles over the stage of HR induced by Tobacco mosaic virus and Cucumber mosaic virus by using digital gene expression analysis. Numerous candidate genes specifically or commonly regulated by these two distinct viruses at early and late stages of the HR were identified, and the dynamic changes of the differently expressed genes enriched in the pathway of plant-pathogen interaction were particularly emphasized. CONCLUSIONS: To our knowledge, this study is the first description of the genetic makeup of C. amaranticolor, providing deep insight into the comprehensive gene expression information at transcriptional level in this species. The 738 RGAs as well as the differentially regulated genes, particularly the common genes regulated by both TMV and CMV, are suitable candidates which merit further functional characterization to dissect the molecular mechanisms and regulatory pathways of the HR-type of virus resistance in Chenopodium.

The Rice stripe virus pc4 functions in movement and foliar necrosis expression in Nicotiana benthamiana.

The Rice stripe virus (RSV) pc4 has been determined as the viral movement protein (MP). In this study, the pc4 gene was cloned into a movement-deficient Tobacco mosaic virus (TMV). The resulting hybrid TMV-pc4, in addition to spreading cell to cell in Nicotiana tabacum, moved systemically and induced foliar necrosis in Nicotiana benthamiana, indicating novel functions of the RSV MP. A systematic alanine-scanning mutagenesis study established the region K(122)-D(258) of the pc4 substantially associated with cell-to-cell movement, and mutants by replacement of KGR(122-124), D(135), ED(170-171), ER(201-202), EFE(218-220) or ELD(256-258) with alanine(s) no longer moved cell to cell. However, only one amino acid group KGR(122-124) was linked with long-distance movement. The region D(17)-K(33) was recognized as a crucial domain for leaf necrosis response, and mutagenesis of DD(17-18) or RK(32-33) greatly attenuated necrosis. The overall data suggested manifold roles of the pc4 during the RSV infection in its experimental host N. benthamiana.

Establishment of a rice transgene flow model for predicting maximum distances of gene flow in southern China.

We aimed to establish a rice gene flow model based on (i) the Gaussian plume model, (ii) data from a three-location x 3-yr field experiment on transgene flow to common rice cultivars (Oryza sativa), male sterile (ms) lines (O. sativa) and common wild rice (Oryza rufipogon), and (iii) 32-yr historical meteorological data collected from 38 meteorological stations in southern China during the rice flowering period. The concept of the gene flow coefficient (GFC) is proposed; that is, the ratio of the transgene flow frequency (G%) obtained from field experiments to the aggregated pollen dispersal frequency (P%) calculated based on the pollen dispersal model. The maximum distances of gene flow (MDGF) to traditional rice cultivars, ms lines, and common wild rice at a threshold value of either 1.0 or 0.1% were determined. The MDGF and its spatial distribution in southern China show that the gene flow pattern is significantly affected by the monsoon climate, the topography, and the outcrossing ability of recipients. We believe that the information provided in this study will be useful for the risk assessment of transgenic rice in other rice-growing regions.

[Comparison of commercialization of transgenic crops in China and world-wide].

Currently, transgenic crops create huge economic, social and ecological benefits with the development of its commercial production. For China, the speed of development and commercialization of transgenic crops is a strategic issue for the sustainable agriculture development and the international competitiveness of our agricultural products. In this paper, we compared and analyzed the status of commercialization of transgenic crops in China and world-wide.

Transgene flow to hybrid rice and its male-sterile lines.

Gene flow from genetically modified (GM) crops to the same species or wild relatives is a major concern in risk assessment. Transgenic rice with insect and/or disease resistance, herbicide, salt and/or drought tolerance and improved quality has been successfully developed. However, data on rice gene flow from environmental risk assessment studies are currently insufficient for the large-scale commercialization of GM rice. We have provided data on the gene flow frequency at 17 distances between a GM japonica line containing the bar gene as a pollen donor and two indica hybrid rice varieties and four male-sterile (ms) lines. The GM line was planted in a 640 m2 in an isolated experimental plot (2.4 ha), which simulates actual conditions of rice production with pollen competition. Results showed that: (1) under parallel plantation at the 0-m zone, the transgene flow frequency to the ms lines ranged from 3.145 to 36.116% and was significantly higher than that to hybrid rice cultivars (0.037-0.045%). (2) Gene flow frequency decreased as the distance increased, with a sharp cutoff point at about 1-2 m; (3) The maximum distance of transgene flow was 30-40 m to rice cultivars and 40-150 m to ms lines. We believe that these data will be useful for the risk assessment and management of transgenic rice lines, especially in Asia where 90% of world's rice is produced and hybrid rice varieties are extensively used.

A large-scale field study of transgene flow from cultivated rice (Oryza sativa) to common wild rice (O. rufipogon) and barnyard grass (Echinochloa crusgalli).

The introgression of transgenes into wild relatives or weeds through pollen-mediated gene flow is a major concern in environmental risk assessment of transgenic crops. A large-scale (1.3-1.8 ha) rice gene flow study was conducted using transgenic rice containing the bar gene as a pollen donor and Oryza rufipogon as a recipient. There was a high frequency of transgene flow (11%-18%) at 0-1 m, with a steep decline with increasing distance to a detection limit of 0.01% by 250 m. To our knowledge, this is the highest frequency and longest distance of gene flow from transgenic rice to O. rufipogon reported so far. On the basis of these data, an adequate isolation distance from both conventional and transgenic rice should be taken for in situ conservation of common wild rice. Meanwhile, there is no evidence of transgene introgression into barnyard grass, even when it has coexisted with transgenic rice containing the bar gene for five successive years. Thus, the environmental risk of gene flow to this weedy species is of little concern.

Validation of a cotton-specific gene, Sad1, used as an endogenous reference gene in qualitative and real-time quantitative PCR detection of transgenic cottons.

Genetically modified (GM) cotton lines have been approved for commercialization and widely cultivated in many countries, especially in China. As a step towards the development of reliable qualitative and quantitative PCR methods for detecting GM cottons, we report here the validation of the cotton (Gossypium hirsutum) endogenous reference control gene, Sad1, using conventional and real-time (RT)-PCR methods. Both methods were tested on 15 different G. hirsutum cultivars, and identical amplicons were obtained with all of them. No amplicons were observed when DNA samples from three species of genus Gossypium, Arabidopsis thaliana, maize, and soybean and others were used as amplified templates, demonstrating that these two systems are specific for the identification and quantification of G. hirsutum. The results of Southern blot analysis also showed that the Sad1 gene was two copies in these 15 different G. hirsutum cultivars. Furthermore, one multiplex RT-quantitative PCR employing this gene as an endogenous reference gene was designed to quantify the Cry1A(c) gene modified from Bacillus thuringiensis (Bt) in the insect-resistant cottons, such as Mon531 and GK19. The quantification detection limit of the Cry1A(c) and Sad1 genes was as low as 10 pg of genomic DNA. These results indicate that the Sad1 gene can be used as an endogenous reference gene for both qualitative and quantitative PCR detection of GM cottons.

[Vascular-specific promoters and cis-regulatory elements].

Vascular-resided bacterial and fungal diseases have caused a great deal of yield loss and quality reduction in crop production world-wide. For genetic engineering of crops resistant to these diseases, it is disirable to have a strong and vascular-specific promoter. This article reviews the progress in identification of vascular-specific promoters and its function. To date, roughly twenty vascular-specific promoters have been documented. The cis-elements and motifs have been studied in detail for the promoters of bean phenylalanine ammonia lyase (PAL2), bean glycine-rich protein (grp 1.8) and Arabidopsis profilin2 (pfn2) in particular.The motif of vs-1 (CATGCTCCGTTGGATGTGGAAGACAGCA) found in grp 1.8 promoter was a cis-element that specificically bind to a transcription activation factor VSF-1 protein (one of the bZIP proteins). Mutation of vs-1 prevented it from binding to VSF-1 that resulted in abolishing the vascular-specific expresson of gus gene. Motifs of AC-I and AC-II found in PAL2 promoter were also found to be essential for vascular-specific expression. In our laboratory we have dissected pfn2 promoter into three domains (A, B, C) through 5'-deletion analysis. In this promoter we have identified two core sequences of ACGT that is commonly found in the binding sites of bZIP protein, the most abundent transcription factor existed in plants. In additon, the pfn2 promoter also contains an AC- I like sequence (CCACCTAC) that is similar to the AC- I motif (CCCACCTACC) found in PAL2 promoter. These promoters and cis-elements may have a wide range of potential applications to the genetic improvement of crops resistant to vascular diseases.